-
Notifications
You must be signed in to change notification settings - Fork 1
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Bug fix: bad sequences included in ASM pattern result
Take filtered sequences as ASM input. Update demo description and test data correspondingly.
- Loading branch information
1 parent
817c380
commit 934b9e4
Showing
3 changed files
with
27 additions
and
20 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
16 changes: 8 additions & 8 deletions
16
.../test/resources/integration/demoExpected/demoRef-10-96-test-plus_bismark.analysis_ASM.txt
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,14 +1,14 @@ | ||
ASM count percentage | ||
TCTCTAATGAGGGAGGAGGCCCGAGGATGGCTGGGTTTGATTTATGACTGGAGGAGAAGGTCCACTTCCCACTGCGAAGCAGGCGAC ref | ||
---------------------**---------------------------------------------------**-------**-- 417 0.5291878172588832 | ||
---------------------@@---------------------------------------------------@@-------@A-- 371 0.47081218274111675 | ||
---------------------**---------------------------------------------------**-------**-- 410 0.5203045685279187 | ||
---------------------@@---------------------------------------------------@@-------@A-- 356 0.4517766497461929 | ||
Methylation level in reads with reference allele: | ||
Relative_CpG_position Methyl_Level | ||
21 0.08173076923076923 | ||
74 0.9206730769230769 | ||
83 0.7718446601941747 | ||
21 0.08068459657701711 | ||
74 0.921760391198044 | ||
83 0.7728395061728395 | ||
Methylation level in reads with alternative allele: | ||
Relative_CpG_position Methyl_Level | ||
21 0.0972972972972973 | ||
74 0.16172506738544473 | ||
83 0.02981029810298103 | ||
21 0.09859154929577464 | ||
74 0.1601123595505618 | ||
83 0.022598870056497175 |